---

########################################

• Receive files from sequencer
• Update where files are saved on amphiprion in sample_data sheet
• • [michelles@amphiprion miseq_2014_04_28]$ pwd
    /local/shared/pinsky_lab/sequencing/miseq_2014_04_28
    Pool7-PCR_S1_L001_R1_001.fastq.gz  Pool7-PCR_S1_L001_R2_001.fastq.gz
    
• Create a mysql database
• • [michelles@amphiprion ~]$ mysql -plarvae168
    
    mysql> create database seq02;
    
    mysql> show databases;
    
    mysql> exit
    Apply stacks configuration to database:
    
    [michelles@amphiprion ~]$ mysql -plarvae168 seq02 < ~/local/share/stacks/sql/stacks.sql
• Make project directory:
  • [michelles@amphiprion ~]$ mkdir 02_seq02
    
• Make directories inside the seq directory
  • [michelles@amphiprion ~]$ cd 01_seq03/
    [michelles@amphiprion 01_seq03]$ mkdir Pool7 samples stacks
• Copy barcodes file over from the boneyard
• • [michelles@amphiprion ~]$ cd 00_boneyard/seq03/
    [michelles@amphiprion seq03]$ cp barcodes ~/02_seq02/
  • nano’d it to only include the 16 barcodes we used in this run
  • saved as barcodes_7
• Make directories inside the seq directory
• • [michelles@amphiprion 02_seq02]$ mkdir Pool7 samples
• make a new names_barcodes tab delimited file: 
• • Open Sample_data in Chrome (yes, it has to be chrome, other browsers don’t work properly as of 10-22-2014)
  • Click on the Pool_contents tab and filter for the pool you are working on (Pool 7)
  • Copy the sample names over to the first column of the Names tab
  • drag down the formula to find the barcode
  • for each pool download as tab delimited "names_Pool7.tsv", etc.
  • delete all of the rows except for the first row (preserve the formula!)
  • Open the document in Komodo and fix the end of line characters by right clicking on the tab and looking at the properties (doing this with google sheets they were already in Unix)
• Copy the names files into the correct pool directories:   
• • nrb176:~ Michelle$ scp -r ~/Downloads/names_Pool7.tsv michelles@amphiprion.deenr.rutgers.edu:~/02_seq02/Pool7
• sign back into the server and run process radtags on the files
• • [michelles@amphiprion ~]$ cd 02_seq02/
    [michelles@amphiprion 02_seq02]$ process_radtags -b barcodes_7 -c -q -r --renz_1 sbfI --renz_2 mluCI -i gzfastq --adapter_1 ACACTCTTTCCCTACACGACGCTCTTCCGATCT -p /local/shared/pinsky_lab/sequencing/miseq_2014_04_28/ -P -o ./Pool7/
    
• Cat the results and remove the original files
• • [michelles@amphiprion Pool7]$ cat_pe names_Pool7.tsv
  • [michelles@amphiprion Pool7]$ rm sample_*.1.fq
    [michelles@amphiprion Pool7]$ rm sample_*.2.fq
    
• Rename files - use the “se” version of dDocent because concatenated all of the files into one file
  
• • [michelles@amphiprion Pool7]$ rename.for.dDocent_se names_Pool7.tsv
    
• Move the renamed files into the samples directory
• • [michelles@amphiprion Pool7]$ mv SPSO* ../samples
    
• Make list all of the samples in a format that can be copied and pasted into denovo_map
• • [michelles@amphiprion Pool7]$ cd ..
    [michelles@amphiprion 02_seq02]$ ls -l ./samples/*.fq | mawk '{print "-s", $9, "\\”}’
• Run denovo_map (batch 2 because this is our second attempt):
• • [michelles@amphiprion 02_seq02]$ nohup denovo_map.pl -b 2 -B seq02 -m 2 -M 4 -n 3 -t -T 10 -o ./stacks -s ./samples/SPSO14_001L052.fq \
    
• Run rxstacks:
• • [michelles@amphiprion 02_seq02]$ rxstacks -b 2 -P ./stacks -o ./rxstacks -t 10 --prune_haplo --lnl_lim -8.0 —lnl_dist

• Make a list of files to run cstacks:
• • [michelles@amphiprion 02_seq02]$ cd rxstacks/
    [michelles@amphiprion rxstacks]$ ls -l ../samples/*.fq | mawk '{print "-s ./"substr($9,12,14), "\\"}'
    
• Run cstacks (ran this as batch 1 on 10-22-14):
• • [michelles@amphiprion rxstacks]$ nohup cstacks -b 2 -o ./ -n 3 -p 10 -s ./SPSO14_001L052 \ 
• Delete intermediate files
• • Batch 1 has been loaded to the sql database so the stacks sample files can be deleted:
  • • [michelles@amphiprion stacks]$ rm SPSO*
  • Don’t think I need file lists anymore, deleting samples (copy file list here just in case)
    
  • • SPSO14_001L052.fq  SPSO14_005L056.fq  SPSO14_009L060.fq  SPSO14_013L064.fq
      SPSO14_002L053.fq  SPSO14_006L057.fq  SPSO14_010L061.fq  SPSO14_014L065.fq
      SPSO14_003L054.fq  SPSO14_007L058.fq  SPSO14_011L062.fq  SPSO14_015L066.fq
      SPSO14_004L055.fq  SPSO14_008L059.fq  SPSO14_012L063.fq
      
    • [michelles@amphiprion 02_seq02]$ rm -r samples/
      
• Amend hand_stacks to reflect proper batch number (and get rid of .F. and .R.’s and .fq's):
• • [michelles@amphiprion 02_seq02]$ nano ~/03_scripts/hand_stacks_10-21-2014.sh
  • saved as hand_stacks_10-23-2014.sh
• Run hand_stacks
• • [michelles@amphiprion 02_seq02]$ cd rxstacks/
    [michelles@amphiprion rxstacks]$ chmod u+x ~/03_scripts/hand_stacks_10-23-2014.sh 
  • [michelles@amphiprion rxstacks]$ nohup hand_stacks_10-23-2014.sh
• Are there any intermediate files that can be deleted?  - Not now…
• Run populations - don’t filter this time around (no -m or -r, etc) - RAN IN SECONDS - small dataset
• • [michelles@amphiprion 02_seq02]$ cd rxstacks/
    [michelles@amphiprion rxstacks]$ nohup populations -b 2 -P ./ -s -t 10
• Create database for rxstacks - we are using the one created above and using it as batch 2
• • Make new database for rxstacks 
  • • [michelles@amphiprion rxstacks]$ 
    • mysql -plarvae168
    • mysql> create database seq02rx;
    • mysql> exit
    • Apply stacks configuration to database:
    • [michelles@amphiprion rxstacks]$ mysql -plarvae168 seq02rx < ~/local/share/stacks/sql/stacks.sql
• Load radtags to database
  
• • [michelles@amphiprion rxstacks]$ nohup load_radtags.pl -D seq02rx -p ./ -b 2 -c -B
• Index database
  
• • [michelles@amphiprion rxstacks]$ nohup index_radtags.pl -D seq02rx -c -t